The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. The origin of haplogroup G is controversial. This value of 12 is uncommon in other G categories other than G1. Am J Hum Genet 2007; 80: 759768. Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in Hum Genet 2009; 126: 707717. Barac L, Pericic M, Klaric IM et al. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. Geographic spread patterns of the P303-derived groups defined by L497, U1 and P15(xP303)-derived P16 and M406 lineages, all of which achieve a peak frequency of at least 10%, are presented in Figures 2bf, respectively. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. (2004) suggested the mutation took place only 9,500 years ago. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. Nasidze I, Quinque D, Dupanloup I et al. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Google Scholar. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. Eur J Hum Genet 2009; 17: 820830. K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. The presence of hg G was first reported in Europe and Georgia5 and later described in additional populations of the Caucasus.6 Subsequently, several data sets containing hg G-related lineages have been presented in studies of different European populations7, 8, 9, 10 and so on, as well as studies involving several Middle Eastern and South Asian populations.4, 11, 12, 13, Hg G, together with J2 clades, has been associated with the spread of agriculture,5 especially in the European context. Haplogroup G is a branch on the maternal tree of human kind. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. The geographic origins of a Y chromosome haplogroup for males can be deciphered from the phylogenetic tree of mankind, or the Y-DNA Haplogroup Tree, maintained by the International Society of Genetic Genealogy ( ISOGG, 2016 ). Distribution. In contrast to its widely dispersed sister clade defined by P303, hg G-M406 has a peak frequency in Cappadocia, Mediterranean Anatolia and Central Anatolia (67%) and it is not detected in most other regions with considerable P303 frequency. There are multiple SNPs which so far have the same coverage as P15. In Lebanon, however, G accounts for 6.5% of the population and in Iran to around 10%. G is found mostly in the north central Middle East and the Caucasus, with smaller numbers around the Mediterranean and eastward. In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran. The results were analyzed using the ABI PRISM program GeneMapper 4.0 (Applied Biosystems). Haplogroup - an overview | ScienceDirect Topics Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. [24] Haplogroup G-M201 is believed to have been relatively absent during Neolithic India; the frequencies of the G2a-P15 subclade for example was negligible in indigenous Indian populations. . Notably no basal G-M201*, Page94*(xM285, P287) chromosomes were detected in our data set. This group was created for the folks who's paternal Y-DNA reflects they belong to haplogroup G2a (G-P15). Am J Hum Genet 2004; 74: 694704. There are seeming pockets of unusual concentrations within Europe. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. Its members include "tzi",[citation needed] the so-called Iceman, who died at least 5,000 years BP in the European Alps. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa . There are additional subclades of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities. ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. Another notable feature is its uneven distribution. Forensic Sci Int-Gen 2007; 1: 287290. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. [16] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. Origin. Haplogroup G ( M201) is a human Y-chromosome haplogroup. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. What is the geographic and historic origin of Y-DNA haplogroups Am J Hum Genet 2004; 74: 788788. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. The coalescence age estimate of 9400 years for P16 coincides with the early Holocene (Supplementary Table S4). Furthermore, markers Page94, U5, U8 and L30 were typed in contextually appropriate samples to establish the position of the five new markers within the phylogeny. The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. [5] Cinnioglu et al. Correspondence to Please help update this article to reflect recent events or newly available information. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. Spatial frequency maps for hg G sub-clades that attained 10% frequency in at least one population were obtained by applying the haplogroup frequencies from Supplementary Table S1. These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. (2000) suggested 17,000 years ago. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. G-L14 | Haplogroup Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. Using Y-STR data, the Td expansion time for all combined P15-affiliated chromosomes was estimated to be 150822217 years ago. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). Flores C, Maca-Meyer N, Gonzalez AM et al. Y-chromosomal diversity in Lebanon is structured by recent historical events. Eur J Hum Genet 2010; 18: 463470. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. In Europeexcept in Italy G2a2b1 constitutes less than 20% of G samples. (This followed the publication of: Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. The Etruscans: a population-genetic study. Finally, to the east, G2a3a-M406 has an expansion time of 8800 years ago in Iran, a time horizon that corresponds to the first Neolithic settlements of the Zagros Mountains of Iran. Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. Am J Hum Genet 2008; 82: 236250. SD was also calculated for the age estimates according to the following formula: 25/1000 (ASD0 variance)/0.00069. Specifically, we intersected these criteria by applying the following filters. Eur J Hum Genet 2010; 18: 348353. Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. Its identification caused considerable renaming of G categories. Kivisild T, Rootsi S, Metspalu M et al. Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. Google Scholar. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. The L141 mutation involves an insertion.[35]. Lacan M, Keyser C, Ricaut FX et al. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a2b1 persons, and DYS392 is almost always 11. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ : Iran: tricontinental nexus for Y-chromosome driven migration. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). Eur J Hum Genet 2004; 12: 855863. Hum Hered 2006; 61: 132143. Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). An assessment of the Y-chromosome phylogeography-based proposal that the spread of G2a-L497 chromosomes originated from Central Europe could be achieved by typing this SNP in the Holocene period human remains from Germany31 as well as those from France and Spain.45, 46 Certainly, Y chromosome represents only a small part of human genome and any population-level interpretation of gene flow in this region would have to be supported by genome-wide evidence. Kharkov VN, Stepanov VA, Borinskaya SA et al. The M527-defined sub-clade is unusual in that it reflects the presence of hg G-U1 that is otherwise rare in Europe. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. In Europe west of the Black Sea, Haplogroup G is found at about 5% of the population on average throughout most of the continent. The formula for the coalescence calculations is as follows: Age=25/1000 ASD0/0.00069. The G-P303 phylogenetic network was constructed using 248 G2a3b-P303-derived 19-locus haplotypes from populations representing Europe, Middle/Near East, South/Central Asia and the Caucasus and belonging to five sub-clades P303*, U1, M527, M426 and L497. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. This is achieved by comparing the haplotypes through the STR markers. G2a2b2a is also found in India. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK. Internet Explorer). It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. The mutation is found on the Y chromosome at 10595022 and is a change from G to C. G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. (2000) suggested 17,000 years ago. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. The hg G-U1 subclade is characterized by several sub-clusters of haplotypes, including a more diverse cluster mostly represented by Caucasus populations. Nonetheless, our approach using high-resolution phylogenetic relationships as well as their phylogeography to infer the possible origin of a genetic variant provides a more plausible deduction than simply the region of highest frequency. The haplogroup G mutation developed about 21,000 to 14,000 years ago. Distribution. International Society of Genetic Genealogy (ISOGG; 2015), "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences", https://en.wikipedia.org/w/index.php?title=Haplogroup_G-M201&oldid=1139571590, Articles with dead external links from January 2020, Articles with permanently dead external links, All articles with bare URLs for citations, Articles with bare URLs for citations from April 2022, Articles with spreadsheet file bare URLs for citations, Short description is different from Wikidata, Articles with self-published sources from October 2020, Articles with unsourced statements from November 2017, Articles with unsourced statements from September 2022, Articles with unsourced statements from July 2017, Wikipedia articles in need of updating from February 2021, All Wikipedia articles in need of updating, Creative Commons Attribution-ShareAlike License 3.0, M201, PF2957, L116, L154, L204, L240, L269, L402, L520, L521, L522, L523, L605, L769, L770, L836, L837, M201, P257/U6, Page94/U17, U2, U3, U7, U12, U20, U21, U23, U33, Other males purported to be members of Haplogroup G include: German-American pioneer and soldier, This page was last edited on 15 February 2023, at 20:17. Semino O, Magri C, Benuzzi G et al. Haplogroup Definition & Meaning | Dictionary.com Article Google Scholar. EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. Network of 248 samples P303 derived from Supplementary Table S3. Am J Hum Genet 2004; 74: 10231034. Evolutionary Biology Group, Estonian Biocentre, Tartu, Estonia, Siiri Rootsi,Mari Jrve,Ildus Kutuev,Krt Varendi,Hovhannes Sahakyan,Doron M Behar,Alena Kushniarevich&Richard Villems, Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, CA, USA, Department of Evolutionary Biology, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia, Institute of Biochemistry and Genetics, Ufa Research Center, Russian Academy of Sciences, Ufa, Russia, Ildus Kutuev,Elza K Khusnutdinova&Rita Khusainova, Departamento de Gentica, Facultad de Biologa, Universidad de La Laguna, Tenerife, Spain, Human Genetics Group, Institute of Molecular Biology, Academy of Sciences of Armenia, Yerevan, Armenia, Hovhannes Sahakyan,Levon Yepiskoposyan&Ardeshir Bahmanimehr, Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia, Institute for Anthropological Research, Zagreb, Croatia, Immunology department, Allergy Research Center, Shiraz University of Medical Sciences, Shiraz, Iran, Department of Human and Molecular Genetics, College of Medicine, Florida International University, Miami, FL, USA, Dipartimento di Biologia e Biotecnologie L. Summary. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201. Chromosome Y microsatellites: population genetic and evolutionary aspects. SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. The highest frequency values for P303 are detected in populations from Caucasus region, being especially high among South Caucasian Abkhazians (24%) and among Northwest (NW) Caucasian Adyghe and Cherkessians39.7% and 36.5%, respectively. Haak W, Balanovsky O, Sanchez JJ et al. Origin. Pericic M, Lauc LB, Klaric IM, Janicijevic B, Rudan P : Review of croatian genetic heritage as revealed by mitochondrial DNA and Y chromosomal lineages. Semino et al. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. Ann Hum Genet 2008; 72: 205214. P257 was first reported in 2008. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. Haplogroup G-M285 - Wikipedia But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. So far all G2a1 persons have a value of 10 at STR marker DYS392. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. Haplogroup G-M201 | Familypedia | Fandom Haplogroup - an overview | ScienceDirect Topics The overall coalescent age estimate (Supplementary Table S4) for P303 is 12600 years ago. Encyclopedia of mtDNA Origins - Discover your maternal lineage. Whatever the date or specific place of origin, part of the G family put down roots predominantly in the area south and east of the Caucasus mountains. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). G2a2b1 is more common in southern Europe than northern Europe. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. Y-STR haplotypes were used to construct phylogenetic networks for haplogroups G-P303, G-P16 and G-M377, using the program Network 4.6.0.0 (Fluxus-Engineering, Suffolk, England, UK) and applying the median-joining algorithm. Almost all L141 men belong to L141 subclades. [23] About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. [41] These classifications are based on shared SNP mutations. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. Although compared with G1-M285, the phylogenetic level of P303 (Figure 1) is shallower but its geographic spread zone covers the whole hg G distribution area (Figure 2b). Haplogroup H However, interpretations based on coarse haplogroup resolution frequency clines are unsophisticated and do not recognize underlying patterns of genetic diversification. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. In other words, these mutations are so unique that they could only come from other cells with the same mutations. JD and JC were supported by ANR program AFGHAPOP No BLAN07-9_222301. The authors declare no conflict of interest. Am J Hum Genet 2012; 90: 573. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. Nei M : Molecular Evolutionary Genetics. There are distinctive Ashkenazi Jewish and Kazakh subclades based on STR marker value combinations. ), Haplogroup M, as of 2017, is also known as K2b1b. Lacan M, Keyser C, Ricaut FX et al. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . Goncalves R, Freitas A, Branco M et al. Amongst the Madjars, G1 was found at a rate of 87%. Excavating Y-chromosome haplotype strata in Anatolia. Origin, Diffusion, and Differentiation of Y-Chromosome Haplogroups E The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. [Origin of European 3/6] First Farmer of Europe and Y-DNA Haplogroup G The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations. Haplogroup LT (L298/P326) is also known as Haplogroup K1. The British samples have inconsistent double values for STR marker DYS19 in many cases. Two sources of the Russian patrilineal heritage in their Eurasian context. PLoS One 2009; 4: e5792. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. Members of this group have been found in Europe and the Middle East.[3]. Similarly, G-P16 and G-M377 networks were created using 104 P16-derived 19-locus haplotypes and 61G-M377-derived 9-locus haplotypes, with both groups representing European, Near/Middle Eastern and central/west Asian populations. Mitochondrial haplogroup N is a "Macro-haplogroup", also called a "Superhaplogroup." All humans who left Africa descended from mtDNA haplogroup L3, and that ancient lineage soon gave rise to two great daughter families, M and N, which, in turn, became the mothers of billions. (Previously the name Haplogroup M was assigned to K2b1d. Int J Legal Med 1997; 110: 141149. Parallel evolution of genes and languages in the Caucasus region. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA. Artefactual values below 0% values were not depicted. Haplogroup G was the first branch of Haplogroup F outside of Africa. Article P15 was identified at the University of Arizona and became widely known by 2002.